• تنويه
 عزيزى القارئ هذه مقالة مترجمة ومنقولة ، وليست دراسة قمت بكتابتها بنفسي لذا أرجو من القرأ إلتماس العذر ، من حيث       أسلوب الكتابة ، وطريقة التعبير .
 

عرفت ذات مرة عالمة عملت في المختبر كل ساعات استيقاظها لأسابيع متتالية. في الواقع لقد عرفت القليل. عندما يظهر اكتشاف كبير في متناول اليد ، يمكن أن يصبح البحث هاجسًا. تخيل ، إذن ، ما الذي يجب أن تشعر به لتفقد السباق لتكون أولًا - أن تُغرف. أشهر أو سنوات من العمل يمكن أن تصبح زائدة عن الحاجة ، أو لا قيمة لها. لا فائدة لأحد.

على الرغم من أنني لم أحصل على أي اكتشاف كبير منذ 25 عامًا كعالم عامل ، إلا أنني مفتون بفكرة ذلك. لأن التعرض للجرف يؤدي إلى إسفين بين قوتين تحفز العلماء: الفضول والأنا. تشعر بسعادة غامرة من تعلم إجابة السؤال الذي أثار هاجسك ، لكن في الوقت نفسه ، سُحقت لمعرفة أنك لن تكون الشخص الذي اكتشفه.

إحدى الحالات الشهيرة ، خاصة ، تجسد خيالي. لم تكن فقط واحدة من أكبر المجارف في تاريخ العلوم ، ولكن العلماء المعنيين تركوا وراءهم أدلة على ردود أفعالهم. أنا أتحدث عن فك شفرة لغة الحمض النووي عام 1961 ، وهي الشفرة الوراثية. عمل كل من سيدني برينر وفرانسيس كريك ، المشهوران الآن كواحد من علماء الوراثة الأكثر ذكاءً في القرن العشرين ، على هذه المشكلة في الفترة من 1953 إلى 1961 ، حيث تعرضوا للضرب من قبل عالم الكيمياء الحيوية الأمريكي غير المعروف.

في عام 2010 ، أصدر المحفوظون خطابات Brenner ودفاتر المختبرات واكتشفوا بعض أوراق Crick المفقودة. في الأوراق ، وفي تصرفات العلماء ، أقسمت أن رد فعلهم على تعرضهم للضرب لاكتشاف تاريخي: شعروا بسعادة غامرة. .

أو على الأقل بدا أنهم كذلك. في عام 2014 ، قبل وفاة برينر بخمس سنوات ، بحثت عنه لأطلب منه ذلك.
لم يكن من السهل العثور على Sydney Brenner. كان لديه مختبرات ومكاتب في سنغافورة وأوكيناوا وفرجينيا وكاليفورنيا. وسافر باستمرار. لقد وجدت مساعدًا إداريًا بالقرب من سان دييغو لم يره منذ عامين ، لكنها كانت تعرف شخصًا ما. عندما اتصلت أخيرًا ، كنت محظوظًا: سنكون في إنجلترا لمدة يوم واحد فقط بعد أسبوع ونصف.

قال: "تعال!" ، وانزلقت إلى الباب المنخفض لمنزله. كان لدى برينر ، 88 عامًا ، حواجب كثيفة وابتسم ابتسامة عريضة من بابا نويل. لكنه قد يكون صريحًا بشكل مقلق بشأن العلماء البارزين الذين اعتبرهم حمقى. قال لي أحدهم: "كان علي أن أشرح له - اسمع ، فكرت ، أن هذا المعتوه لا يفهم". كان بإمكاني أن أرى أنه قد تباطأ جسديًا مع تقدم العمر ، لكنه كان رشيقًا عقليًا. كنت سعيدًا لأنني أعيد قراءة العديد من مقالاته البحثية في الخمسينيات والستينيات من القرن الماضي ، لذا فقد حاولت مواكبة ذلك.

جلسنا في غرفة صغيرة مشرقة مزدحمة بالنباتات بينما ربيته ، جوناثان ، طهي لنا الغداء. كواحد من مؤسسي البيولوجيا الجزيئية ، ربما كان برينر قد جعل نفسه غنيًا إذا أراد ذلك. لكن كان معروفًا أنه يتحدث بألوان متحركة عن العلم ، وليس عن المال ، وكان منزله متواضعًا. شعرت بأكل كبير على المائدة في مطبخه الصغير ، حيث تصطف الألواح والأكواب على الأرفف المفتوحة ويمكنني الوصول إلى الثلاجة من مقعدي.
بدأ برينر ، مستدقًا قدمه ، في إعادتي إلى كيفية ربط مشكلة الترميز به أولاً. يتكون البروتين النموذجي من بضع مئات من الأحماض الأمينية ، يرتبط كل منها بالخرز التالي الذي يشبه الخيط. هناك 20 نوعا مختلفا من هذه الخرزات. تلتصق بعض الخرز ببعض الخرز الأخرى ، وبعضها تلتصق بالماء ، بحيث يتم طي كل سلسلة بشكل طبيعي في شكل محدد في الماء ، مما يشكل أحد أجزاء آلة الحياة. هناك البروتينات التي تبدو وتعمل مثل قضبان صغيرة وذراع ، والطوب المتشابكة ، والعجلات.

قبل أوائل الخمسينيات ، أخبرني برينر ، أن العديد من العلماء "ظنوا أن البروتينات كانت عبارة عن بوليمرات غامضة" ، وهي مجرد نماذج من الخرزات التي تكررت أو كانت لها تسلسلات غير محددة. ولكن بحلول عام 1953 ، تم العثور على البروتينات التي لديها تسلسلات محددة من الخرز ، وكان يشبه الحمض النووي رمزًا سريًا مكونًا من أربعة أحرف: A و T و G و C. يبدو أن كل جين في الحمض النووي يمثل مجموعة من التعليمات لتجميع حبات البروتين بالترتيب الصحيح. كان السؤال الكبير ، كيف؟

من الواضح أن الأحرف الأربعة من رمز الحمض النووي لا يمكن أن تمثل حمضًا أمينيًا واحدًا فقط لكل منهما ، لأنها لا يمكنها معًا تشفير أكثر من أربعة أنواع من الأحماض الأمينية العشرين. باستخدام حرفين متتاليين بدلاً من ذلك - AT ، AG ، AC ، TA ، وما إلى ذلك - أعطى فقط 16 مجموعة ممكنة ، عدد قليل جدًا. قدمت ثلاث رسائل 64 مجموعة ، أكثر من اللازم لصنع 20 من الأحماض الأمينية. لذا من المحتمل أن يكون الحد الأدنى لحجم الكلمات في الحمض النووي هو ثلاثة أحرف ، لكن أربعة أحرف أو أكثر كانت ممكنة أيضًا.

ألقِ نظرة على مدى صعوبة حل الكود الخاص بالبروتين ، الأنسولين في هذه الحالة ، حتى لو كنت تعرف شكل تسلسل الحمض النووي والبروتين. إليك جزءًا من تسلسل بروتين الأنسولين:
نعلم اليوم أن تسلسل الحمض النووي للأنسولين يشبه هذا:
TTCGTCAACCAGCATCTGTGTGGCTCCCACCTGGTGGAGGCGCTGTACCTGGTGTGCGGAGAGCG 
 حتى مع هذه المعرفة ، يعد فك شفرة كيفية الانتقال من الحمض النووي إلى البروتين تحديًا كبيرًا. وفي عام 1953 ، لم يكن أحد يعرف تسلسل الحمض النووي هذا ولا أي تسلسل الحمض النووي لهذه المسألة.

هذا لم يمنع الناس من محاولة كسر الشفرة. اقترح الفيزيائي النظري جورج جامو أن كل حبة من الأحماض الأمينية قد تنسجم بإحكام مع الثقوب على شكل الماس على طول منتصف حلزون الدنا المزدوج. كان يعتقد أن الحمض النووي يمكن أن يعمل كقالب فيزيائي لخيط التوتير بالترتيب الصحيح ، مثل صف من ثقوب الربط لأوتاد مختلفة الشكل. كانت الأبعاد صحيحة ، ويحدث أن أحرف الحمض النووي الأربعة تحدد بالضبط 20 نوعًا من هذه الثقوب.

وقال برينر: "لكن لا برينر ولا كريك اعتقدوا أن كود جامو يمكن أن ينجح" لأنه أولاً كان يقرأ الأشياء بطريقتين. الحمض النووي له اتجاه ، شيء تم تجاهله أو لم يفهمه Gamow. بحلول سبتمبر 1956 ، اكتشف برينر أن حل Gamow لا يمكن أن يكون صحيحًا ، من خلال إظهار أنه سيمنع بعض الأحماض الأمينية من الجيران.

على الرغم من أن جامو كان مخطئًا ، إلا أن فكرته أثارت خيال برينر وكريك. فكر جامو كمشفّر ، من حيث المعلومات والرموز ، والذي كان جديدًا لمعظم علماء الحياة في ذلك الوقت. أخبرني برينر أن المئات من علماء الكيمياء الحيوية الذين درسوا كيفية صنع البروتينات "كانوا مهتمين فقط بمكان مصدر رباط الببتيد". بدأ كريك وبرينر ، بدفع من Gamow ، في التفكير في نقل المعلومات.

هذا أدى إلى بعض الأفكار الذكية. في فبراير 1957 ، اقترح كريك كيف يمكن للآلية الموجودة بداخلنا التي تقرأ الحمض النووي معرفة أين تتوقف كل كلمة في تسلسل الحمض النووي وتبدأ المرحلة التالية. حتى في حالة عدم وجود مسافات أو علامات ترقيم ، فإن الجملة الإنجليزية المكونة من كلمات مؤلفة من 3 أحرف مثل "Theboyatepieandham" قابلة للفك. هذا ليس فقط لأنه يحتوي على كلمات منطقية ، ولكن أيضًا لأننا نجد كلمات هراء فقط إذا بدأنا في المكان الخطأ ونعد ثلاثة أحرف في المرة الواحدة. اقترح كريك أنه في كود الحمض النووي ، قد تكون هناك كلمات خاصة "منطقية" ، والتي يمكن أن تملي إطار القراءة لآلية صنع البروتين.

لقد أوضح كريك أن بعض مجموعات الحروف لا يمكن أن تكون كلمات حساسة. على سبيل المثال ، لن يعمل الحمض الأميني المحدد بواسطة AAA لأن كلمتين من كلمتين متتاليتين ، AAAAAA ، ستجعل من الصعب العثور على إطار القراءة. لإنشاء مجموعة من الكلمات المكونة من ثلاثة أحرف فقط من A و T و G و C ، يحسب زميل Crick's أنه لا يقتصر الأمر على AAA ولكن 43 من المجموعات الـ 64 المكونة من ثلاثة أحرف المحتملة ستحتاج إلى استبعادها ككلمات لا معنى لها - ترك بالضبط 20 كلمة من ثلاثة أحرف ممكنة ، العدد السحري للأحماض الأمينية. لقد كان حلا واعدا وذكيا ، لكنه تبين أنه كان خاطئا. نحن نعلم الآن أن كل الكلمات تقريبًا عبارة عن كلمات منطقية ، بما في ذلك الكلمات المصنوعة من تكرار الحروف. مقترحات مثل هذا ، رغم ذلك ، كانت مفيدة في تشكيل أسئلة واضحة حول الكود.

في عام 1958 ، فكر برينر في طريقة للانتقال من المقترحات النظرية إلى العبث مباشرة بالحمض النووي. بالتفكير في نتائج أحد الزملاء بشأن فيروسات الحمض النووي ، فقد تخمن بعمق أن صبغة صفراء زاهية تسمى بروفلافين قد تؤدي إلى حذف حرف واحد أو إضافات في الحمض النووي ، وأنها قد تطرق قراءة الحمض النووي خارج الإطار. إذا كان إطار القراءة مهمًا ، فإن البروتين المنتج لن يكون له أي معنى - فكر "فتى أكل الفطيرة ولحم الخنزير" ليصبح "Heb oya tep iea ndh am." بدأ هو و Crick العمل معًا في المختبر ، حيث ينمو فيروسات الحمض النووي على ألواح بتري . سوف تصيب الفيروسات البكتيريا ، تاركة ثقبًا ذو حجم مميز في حديقة البكتيريا عندما كان البروتين الموجود في فيروس الحمض النووي يعمل بشكل صحيح - إذا كان التغير في الحمض النووي لم يعطل البروتين الناتج. أخبرني برينر: "إنك تستطيع التنبؤ من هذه الثقوب بأشياء حول البنية الداخلية للحمض النووي" ، "بدا لي دائمًا أنه رائع".
قام برينر وكريك بدمج المسوخات ووجدوا أن معظم الطفرات التي يسببها الصباغة يمكن كبتها بواسطة بعض المسوخات الأخرى التي يسببها الصباغة. نظرًا لأن الصبغة قد أضافت خطابًا وأحيانًا حذفت حرفًا ، فقد بدأوا في استدعاء التغييرات "+" و "-" ، والتي اضطروا إلى تعيينها بشكل عشوائي منذ معرفة أيهم كان مستحيلًا. دمج + مع - غالبًا ما عادت الفيروسات مرة أخرى إلى وضعها الطبيعي ، كما لو أن هذا استعاد إطار القراءة العادي عن طريق كسب وفقدان حرف في نفس امتداد التسلسل ، في حين أن الجمع بين + مع + أو - مع - لم يحدث أبدًا.
وكانت النتائج منطقية. إذا كانت نظريتهم صحيحة ، فكان برينر وكريك في طريقهما نحو كسر الشفرة في النهاية. لم يتمكنوا من قراءة الحروف الفردية في الحمض النووي ، ولكن بعد ثماني سنوات من العمل ، بدا الأمر كما لو كانوا يستطيعون على الأقل تغيير الحروف بطرق يمكن التنبؤ بها. عمل برينر ليلا ونهارا. أصبح كريك ، الذي نادراً ما قام بالتجارب ، مستهلكًا من قِبلهم أيضًا ، في بعض الأيام ، عاد من المختبر عبر كامبريدج لزيارة منزله فقط لتناول وجبات الطعام والنوم.
في أغسطس 1961 ، حضر أكثر من 5000 عالم إلى موسكو لمدة خمسة أيام من المحادثات البحثية في المؤتمر الدولي للكيمياء الحيوية. بعد يومين ، أخبره مات ميسيلسون ، صديق لـ Crick ، ​​الخبر: لقد تم حل الكلمة الأولى من الشفرة الوراثية ، بواسطة شخص آخر. في محادثة صغيرة بعد ظهر يوم الجمعة في الكونغرس ، في غرفة خالية في الغالب ، أفاد مارشال نرينبيرغ - عالم الكيمياء الحيوية الأمريكي والمجهول بالكامل لكريك وبرينر - أنه قد ألقى خطابًا واحدًا متكررًا في نظام لصنع البروتينات ، وأنتج بروتين مصنوع من وحدات مكررة من واحد فقط من الأحماض الأمينية. تم حل الكلمة الأولى من التعليمات البرمجية. وكان من الواضح أن نهج نيرنبرغ سيحل قريباً الكود بأكمله.

إليكم المكان الذي أحب تخيل ما كنت سأفعله لو كنت كريك. بالنسبة لشخص مدفوع بالفضول فقط ، كانت نتيجة Nirenberg نبأ رائع: كانت الإجابة التي طال انتظارها تصل. سيتم كسر الشفرة الوراثية. ولكن بالنسبة لشخص لديه الرغبة الإنسانية في إرفاق اسم الشخص بالاكتشافات ، لم يكن الخبر سيئًا. كان الكثير من أعمال Crick and Brenner التي دامت حوالي عقد من الزمن حول مشكلة الترميز على وشك أن تصبح زائدة عن الحاجة.

أود أن أصدق أنني كنت سأتصرف بشرف. لم أكن قد أوضحت أن نرينبرغ وجد نفسي ، مما أدى إلى تلفيق الأسباب التي جعلتها غير مقنعة. لم أكن لأعود إلى مختبري وعملت بشكل أسرع قليلاً لنشر عملي الخاص في أقرب وقت. لقد رأيت العلماء يتفاعلون هكذا مع المنافسة. أود أن أصدق أنني كنت سأقبل الهزيمة وهنأت نيرنبرغ. بالطبع ، لن أعرف أبدًا ما كنت سأفعله.

كانت استجابة كريك ، بالنسبة لي ، رائعة ومثالية. لقد ناشد Nirenberg لإعطاء حديثه مرة أخرى ، هذه المرة للإعلان عن النتيجة لأكثر من 1000 شخص في ندوة كبيرة ترأسها Crick. يبقى كتيب اجتماع كريك في موسكو كقطعة أثرية لقراره ، حيث كتب "نرينبرج" مكتوب بخط اليد بالحبر الأزرق ، وسهم طويل يدرج في جدول مكتظ بالفعل العالم الذي تخلص منه. وعندما وصل Nirenberg إلى المرحلة ، ذكر أن مختبره قد حل للتو كلمة ثانية من الكود.

سيكتب Crick لاحقًا أن الجمهور في موسكو "تعرض للكهرباء" نتيجة لنتيجة Nirenberg ، وتغيير الكلمة لاحقًا إلى "مدهش". ربما شعر كريك بالدهشة والكهربة. لكن خيبة الأمل؟ إذا شعر كريك ببعض خيبة الأمل ، فلم يكن واضحًا لميسيلسون ، الذي وصف رد فعل كريك المبدئي على الأخبار بأنه "فرح". "ماذا يمكن أن يكون؟" ، أوضح لي ميسيلسون عبر الهاتف ، "بالله ، كنا تعرف الإجابة في حياتنا! "

حتى Meselson ، الذي كان لديه برنامج أبحاث خاص به حول DNA ، عانق Nirenberg بشكل متهور في نهاية حديثه. حاولت تخيل رجلين من تلك الحقبة يعانقان تلقائيًا في قاعة محاضرات في مؤتمر ، خاصة عندما كان أحدهما عالِمًا في علم الوراثة وآخرًا في الكيمياء الحيوية. أخبرني ماكسين سينجر ، عالم الكيمياء الحيوية الذي أعطى نيرنبرغ الحمض النووي الريبي الذي يحتاجه لتجاربه ، أن "الكيميائيين الحيويين وعلماء الوراثة كانوا متشككين من بعضهم البعض" ، وهو ما ردده برينر شخصيًا لي.

بعد وقت قصير من اجتماع موسكو ، قدم كريك وبرينر مساهمة مهمة. لقد عرفوا بحلول ذلك الوقت أن إدخال أو حذف حرف أو حرفين في الحمض النووي الفيروسي من شأنه تعطيل البروتين الناتج. لكنهم رأوا الآن أن إدخال أو حذف ثلاثة أحرف يمكن أن يجعله يعمل مرة أخرى ، كما لو أن هذا استعاد إطار القراءة الصحيح. كانت النتيجة ضمنية أن كود الحمض النووي كان يتألف من كلمات طولها ثلاثة أحرف. كان هذا مكونًا مهمًا لحل الشفرة ، ربما بنفس أهمية اكتشاف Nirenberg.

تكشف الرسائل من Crick إلى Nirenberg من عام 1962 أن Crick وزملاؤه حاولوا إجراء تجارب مثل Nirenberg لفترة قصيرة ، مما جعلني أتساءل عما إذا كان يحاول الحصول على بعض الفضل في اكتشاف الرمز. لكن هذه الرسائل ونص كريك في خطاب إذاعي لهيئة الإذاعة البريطانية عام 1962 أوضحهما ما شعر به - كانت مجموعة نيرنبرغ هي التي تستحق الفضل في تحقيق هذا الإنجاز الحقيقي. "لا ، لقد صدق ذلك بالتأكيد" ، أخبرني برينر ، عندما سألت عما إذا كان كريك لطيفًا. سألت برينر ما هو رد فعله الخاص لسماع نتيجة Nirenberg. وقال "لقد اعتقدنا أن هذا كان مهمًا جدًا ... كان جيدًا للغاية". اعتقدت أنه كان رواقًا ، لكنني عندما ضغطت عليه مرة أخرى وتحدثنا أكثر ، أصبحت مقتنعًا أنه كان أيضًا متحمسًا لتعلم الإجابة.

من الصعب المبالغة في أهمية عمل فك التشفير الذي قام به نيرنبرغ وزملاؤه. معظم التطورات الرئيسية في البيولوجيا الحديثة التي حدثت منذ الاعتماد عليها. يستخدم مختبري الخاص كل يوم. إن الجدول الدوري للعلماء الكيميائيين هو الأساس لجميع الإكتشافات المستقبلية. بالطبع اعتمد Nirenberg على عمل الآخرين من قبله ، وقام العديد من العلماء الآخرين ، بما في ذلك Brenner and Crick ، ​​بتحسين نتائجه مع اكتشافات مهمة أخرى. ولكن هنا كان معلما العلوم. وكان الناس الذين تعرضوا للضرب على الجواب متحمسون. أوضح برينر أنه "من الممكن أن نواجه مشاكل أكثر أهمية".

من السهل على الأقل خسارة النتيجة اليوم كما كانت في عام 1961. نحاول ألا نجري بحثًا لا لزوم له. ولكن في كثير من الأحيان يكون الدافع وراء العديد من العلماء هو نفس الأسئلة ، لذلك في بعض الأحيان يمكننا أن نجد أنفسنا نسابق بعضنا البعض. وفقدان السباق له عواقب. التمويل يمكن أن يتعرض للخطر. يمكن الخروج عن المسار الوظيفي. يمكننا أن نشعر بالتوتر ، في بعض الأحيان ، بين ما هو جيد للعالم الفردي وبين ما هو جيد للتقدم العلمي. يمثل رد فعل كريك وبرينر نموذجًا لي ، كما هو الحال بالنسبة لجميع العلماء. كما أخبرني برينر عن طريق فراق النصيحة: "افعل أفضل التجارب التي يمكنك القيام بها ، وأقول دائمًا الحقيقة. هذا كل شئ."


يرأس بوب جولدشتاين معمل أبحاث الأحياء في جامعة نورث كارولينا في تشابل هيل.
Share To:

Mohamed Hassan

Post A Comment:

0 comments so far,add yours